Filters
Technology
Platform
GSE115410
Homo sapiens
9 Downloadable Samples
Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Understanding gene expression profile and transcriptional regulation of healthy adult human hepatocytes
Publication Title
Differentiation in stem/progenitor cells along fetal or adult hepatic stages requires transcriptional regulators independently of oscillations in microRNA expression.
Sample Metadata Fields
Specimen part, Time
View Samples- Mus musculus
- 6 Downloadable Samples
Illumina HiSeq 2500
Description
Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-ß-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1?-dependent and –independent pathways Overall design: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500 genotype/variation: CYPKO: Sample 1,Sample 2,Sample 3 genotype/variation: G6PD: Sample 4,Sample 5,Sample 6 biological replicate: Sample 1,Sample 2,Sample 3 biological replicate: Sample 4,Sample 5,Sample 6
Publication Title
Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.
Sample Metadata Fields
Specimen part, Subject
View Samples- Homo sapiens
- 21 Downloadable Samples
- Affymetrix HT Human Genome U133A Array (hthgu133a)
Description
Microarrays were used to determine relative global gene expression changes upon introduction of EMT-inducing or control vectors.
Publication Title
Core epithelial-to-mesenchymal transition interactome gene-expression signature is associated with claudin-low and metaplastic breast cancer subtypes.
Sample Metadata Fields
Specimen part
View Samples- Arabidopsis thaliana
- 22 Downloadable Samples
- Arabidopsis Gene 1.0 ST Array (aragene10st)
Description
With frequent fluctuations in global climate, plants often experience co-occurring dry-wet cycles and pathogen infection and this combination adversely affects plant survival. In the past, some studies indicated that morpho-physiological responses of plants to the combined stress are different from the individual stressed plants. However, interaction of drought stressed or drought recovered plants with pathogen has not been widely studied at molecular level. Such studies are important to understand the defense pathways that operate as part of combined stress tolerance mechanism. In this study, Arabidopsis plants were exposed to individual drought stress (soil drying at 40% FC, D), Pseudomonas syringae pv tomato DC3000 (PStDC3000), infection and their combination. Plants recovered from drought stress were also exposed to PStDC3000. Beside we have also infiltrated P. syringae pv tabaci (PSta, non-host pathogen) individually or in combination with drought stress. Using Affymetrix WT gene 1.0 ST array, global transcriptome profiling of plants leaves under individual drought stress and pathogen infection was compared with their combination. Results implicate that plants exposed to combined drought and pathogen stress experience a new state of stress where each combination of stressor and their timing defines the plant responses and thus should be studied explicitly.
Publication Title
Global Transcriptional Analysis Reveals Unique and Shared Responses in Arabidopsis thaliana Exposed to Combined Drought and Pathogen Stress.
Sample Metadata Fields
Specimen part
View Samples- Escherichia coli k-12
- 6 Downloadable Samples
- Affymetrix E. coli Genome 2.0 Array (ecoli2)
Description
The most important approach to the development of platform organisms for recombinant protein production relies on random mutagenesis and phenotypic selection. Complex phenotypes, including those associated with significant elevated expression and secretion of heterologous proteins, are the result of multiple genomic mutations. Using next generation sequencing, a parent and derivative hypersecreter strain (B41) of Escherichia coli were sequenced with an average coverage of 52.8X and 55X, respectively. A new base-pair calling program, revealed a single nucleotide polymorphism in the B41 genome at position 1,074,787, resulting in translation termination near the N-terminus of a transcriptional regulator protein, RutR, coded by the ycdC gene. We verified the hypersecretion phenotype in a ycdC::Tn5 mutant and observed a 3.4-fold increase in active hemolysin secretion, consistent with the increase observed in B41. mRNA expression profiling showed decreased expression of tRNA-synthetases and some amino acid transporters in the ycdC::Tn5 mutant. This study demonstrates that power of next generation sequencing to characterize mutants leading to successful metabolic engineering strategies for strain improvement.
Publication Title
A single nucleotide polymorphism in ycdC alters tRNA synthetase expression and results in hypersecretion in Escherichia coli.
Sample Metadata Fields
No sample metadata fields
View Samples- Caenorhabditis elegans
- 4 Downloadable Samples
- Illumina HiSeq 2000
Description
Purpose: The goal of this study is to identify differentially expressed genes in pry-1/Axin mutant compare to N2 wild-type (WT). Our study represents the first analysis of Axin transcriptome in C. elegans and facilitates investigations of axin mediated processes. Overall design: Whole animal total RNA was extracted from L1 synchronized worms and mRNA profiles of WT and pry-1(mu38) animals were generated by paired end deep sequencing, using Illumina HISeq 2000. The sequence reads that passed quality filters were analyzed using ce6 with Burrows–Wheeler Aligner (BWA) followed by eXpress to estimate transcript abundances. Differentially-expressed genes were called at a false discovery rate (FDR) of 0.05% using the DESeq package in R.
Publication Title
PRY-1/Axin signaling regulates lipid metabolism in Caenorhabditis elegans.
Sample Metadata Fields
Cell line, Subject
View Samples- Homo sapiens
- 29 Downloadable Samples
- Affymetrix Human Exon 1.0 ST Array [transcript (gene) version (huex10st)
Description
Gene expression studies are used to help identify disease-associated genes, by comparing the levels of expressed transcripts between cases and controls, and to identify functional genetic variants known as expression quantitative loci (eQTLs). While many of these studies are performed in blood or lymphoblastoid cell lines due to tissue accessibility, the relevance of expression differences in tissues that are not the primary site of disease is unclear. Further, many eQTLs are tissue specific. Thus, there is a clear and compelling need to conduct gene expression studies in tissues that are specifically relevant to the disease of interest. One major technical concern about using autopsy-derived tissue is how representative it is of physiologic conditions, given the effect of postmortem interval on tissue degradation.
Publication Title
Postmortem cardiac tissue maintains gene expression profile even after late harvesting.
Sample Metadata Fields
Specimen part, Disease, Cell line
View Samples- Mus musculus
- 12 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
Purpose: To identify the changes in postnatal mouse conjunctival forniceal gene expression and their regulation by Klf4 around eye opening stage when the goblet cells first appear.
Publication Title
Mouse conjunctival forniceal gene expression during postnatal development and its regulation by Kruppel-like factor 4.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 9 Downloadable Samples
- Illumina Genome Analyzer IIx
Description
The goal of this study is to compare genes expressed by IFN-gamma treated HTR-8/SVneo cells to genes expressed in untreated control HTR-8/SVneo cells to identify genes which play a role during IFN-gamma-mediated HTR-8/SVneo cells invasion Overall design: cDNA libraries were made from total RNA of untreated control and 24 h IFN-gamma treated samples by TruSeq RNA Library Prep Kit v2. Deep sequencing of cDNA libraries were performed with the help of Illumina Genome Analyzer IIx. Raw sequence data was imported into the CLC Genomics Workbench 6.5.1. software. The sequence reads were trimmed for adapter sequences and low quality base. The trimmed raw sequences were subjected to mRNA-sequence analysis, by mapping them to Human Genome GRCH37.p.13 .
Publication Title
BST2 regulates interferon gamma-dependent decrease in invasion of HTR-8/SVneo cells via STAT1 and AKT signaling pathways and expression of E-cadherin.
Sample Metadata Fields
Specimen part, Treatment, Subject
View Samples- Homo sapiens
- 5 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Understanding the identity of lineage-specific cells arising during manipulations of stem cells is necessary for developing their potential applications. For instance, replacement of crucial functions in organ failure by transplantation of suitable stem-cell-derived cells will be applicable to numerous disorders, but requires insights into the origin, function and fate of specific cell populations. We studied mechanisms by which the identity of differentiated cells arising from stem cells could be verified in the context of natural liver-specific stem cells and whether such differentiated cells could be effective for supporting the liver following cell therapy in a mouse model of drug-induced acute liver failure. By comparing the identity of naturally occurring fetal human liver stem cells, we found that cells arising in cultures of human embryonic stem cells (hESCs) recapitulated an early fetal stage of liver cells, which was characterized by conjoint meso-endoderm properties. Despite this fetal stage, hESC-derived cells could provide liver support with appropriate metabolic and ammonia-fixation functions, as well as cytoprotection, such that mice were rescued from acute liver failure. Therefore, spontaneous or induced differentiation of human embryonic stem cells along the hepatic endoderm will require transition through fetal-like stages. This offers opportunities to prospectively identify whether suitable cells have been generated through manipulation of stem cells for cell therapy and other applications.
Publication Title
Spontaneous origin from human embryonic stem cells of liver cells displaying conjoint meso-endodermal phenotype with hepatic functions.
Sample Metadata Fields
Specimen part
View Samples